Rewrite Please 1. Write a brief outline of the mechanisms in which DNA is used to generate protein. You do not need to provide a fine level of detail, but ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells 2. Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease. 3. Finally – using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon. You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain. Link for Chapter 15: https://my.uopeople.edu/pluginfile.php/1015434/mod_page/content/6/BIOL1121-Textbook-Ch11_Ch20.pdf 1. aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc 2. aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
Why Choose Us
Top Quality and Well-Researched Papers
We always make sure that writers follow all your instructions precisely. You can choose your academic level: high school, college/university or professional, and we will assign a writer who has a respective degree.
Professional and Experienced Academic Writers
We have a team of professional writers with experience in academic and business writing. Many are native speakers and able to perform any task for which you need help.
Free Unlimited Revisions
If you think we missed something, send your order for a free revision. You have 10 days to submit the order for review after you have received the final document. You can do this yourself after logging into your personal account or by contacting our support.
Prompt Delivery and 100% Money-Back-Guarantee
All papers are always delivered on time. In case we need more time to master your paper, we may contact you regarding the deadline extension. In case you cannot provide us with more time, a 100% refund is guaranteed.
Original & Confidential
We use several writing tools checks to ensure that all documents you receive are free from plagiarism. Our editors carefully review all quotations in the text. We also promise maximum confidentiality in all of our services.
Customer Support 24/7
Our support agents are available 24 hours a day 7 days a week and committed to providing you with the best customer experience. Get in touch whenever you need any assistance.
Try it now!
How it works?
Follow these simple steps to get your paper done
Place your order
Fill in the order form and provide all details of your assignment.
Proceed with the payment
Choose the payment system that suits you most.
Receive the final file
Once your paper is ready, we will email it to you.
Services we offer
You do not have to soldier through school on your own! We are what you need.
Essays
Your high school and campus essays have never been easier to complete. At any time of the day, and any type of paper, look to us for professional help and maintain your grades. we are available 24/7 to solve your essay problems and give you constructive and lasting solutions. School just became easier for you because you discovered us. Forget about the struggles of writing essays and live in the moment as you should.
Research
Dissertation papers
some papers are not just simply papers. they require meticulous research and studies. you might need to go as far as choosing a sample group to perform your research on. we know how hard and time-consuming dissertation papers can be, but here is some good news; we have professionals that thrive in that field. let us work on your reserach, thesis and dissertation papers and ease the stress you would have. you can get the best grades at pocket friendly prices and without all the struggles.
Admissions
Admission and Business Papers
An admissions letter is an essay you will write before you join the institution. If you want someone who will present you as an irresistible candidate, look no further. We will write you the best paper that will get your foot right through the door. Your business proposals will also be handled by the best in the industry. You will be a testament to our services.
Editing
Editing and Proofreading
Our editorial team of professionals will take your papers through multiple checks to ensure that you have no errors, mistakes or cases of plagarism. Your paper will achieve professional status because you chose to trust expert. We also include citations and sources using the correct format as required by your institution. Whether you wat it in APA, MLA, Chicago or Harvard, we have specialised in all writing formats.
Writing
Rewriting services
sometimes, you spend hours and hours working on a paper but its just not giving the content as you had hoped. if this is what you feel, you shouldnt hand in that paper. instead, let us help you rewrite it so that it says what you had originally intended. all you need to do is allow us to read your first draft, collect your main points and ideas and tailor it to make sense and give you what you were hoping for. as you develop your writing skills, don allow your grades to fumble. that is why we are here for you.